European Journal of Medical Research and Clinical Trials
Research

Genetic Diversity and Structuring of the BRAF gene in Breast Tumors

Received Date:December 03, 2019 Accepted Date:December 27, 2019 Published Date:December 30, 2019

Citation:Ahmed Mohamed Mze (2019) Genetic Diversity and Structuring of the BRAF gene in Breast Tumors. Eur J Med Res Clin Trials 1: 1-11.

Abstract

The International Agency for Research on Cancer (IARC) estimates an increase in breast cancer worldwide. In Senegal, the most common malignant tumour in women is breast cancer. But also in Senegal as in most African countries, benign tumours occupy an important place in mammary pathologies. To better understand the impact of nucleotide variability and genetic instability of benign and malignant breast tumours, we used the BRAF gene, which is a nuclear gene. This work allowed us to compare the polymorphism, diversity, structure and genetic evolution of exon 15 of the BRAF gene between patients with benign tumours, malignant breast tumours and control subjects. The analysis at the identification of mutation of exon 15 of the BRAF gene led us to conclude that BRAF was mutated in (1.5%) of cases. We observed a synonymous mutation A598A in malignant tumours. Our results showed that somatic mutations of this BRAF gene were common in Senegalese patients with both benign and malignant breast tumours. So our results allowed us to conclude that the BRAF gene is involved in breast tumours.

Keywords: cancer; breast; mutations; BRAF

Introduction

BRAF is a proto-oncogene involved in the KRAS MAP-kinase intracellular signaling pathway. The activation of membrane receptors by binding with their specific ligands induces a cascade activation of this pathway and the stimulation of several cellular functions. This occurs in many types of cells. BRAF is normally activated by RAS proteins. It can also be activated by mutations called "function gain" or "activators"; the proto-oncogene then becomes an oncogene. Activating mutations of the BRAF gene were first detected in human tumors about eighteen years ago [1], and their frequency varies greatly according to tumour type. Mutations generally appear during the early phases of oncogenesis. BRAF mutations are mainly located in the exon 15 activator segment, i.e. acquired, somatic and non-germinal mutations [2]. The absence of germline mutation can be explained by molecular genetic experiments in mice: BRAF mutations induce embryonic lethality [2]. The most frequent mutation is a localized punctually mutation at exon 15 (thymine [T] 1799 has been transformed into adenine [A] - gTg/gAg) substituting a valine (V) into glutamic acid at position 600 of the protein (V600E); this mutation is found in the vast majority of cancers with a mutated BRAF form [1]. The mechanisms of acquisition of the V600E mutation in the protein are probably linked to alternative mechanisms that have not yet been identified. The mutated protein BRAF V600E has 500 times more kinase activity than the wild form of BRAF, which stimulates ERK protein phosphorylation and cell signaling in a disproportionate way [1]. Apart from the V600E mutation, other somatic mutations of BRAF have been described in human melanomas:

In mutated melanomas for BRAF, 74 to 90% are V600E and 16 to 29% are V600K. Depending on the studies, the proportions of one type of mutation compared to another are slightly different. BRAF's amino acid V600 is located in the kinase activation domain, near the threonine 599 and serine 602 residues on which phosphorylation induces kinase activity. The V600E mutation could thus simulate the phosphorylation of threonine 599 and serine 602. Another hypothesis of the uncontrolled activation mechanism is the increase in exposure of the activation segment when a small hydrophobic amino acid (valine) is replaced by a hydrophilic residue (glutamic acid), [3]. The BRAF gene is mutated in the majority of patients with melanoma and a minority of patients with breast, colon and lung cancer [4]. In this study, the hypothesis of the existence of nucleotide mutations involved in breast tumors in Senegalese women has been put forward. For this purpose, exon 15 of the BRAF gene, which is a nuclear gene, was chosen to test this hypothesis.

Methodology
Patients and samples

The study involves sixty-six (66) surgical samples composed of malignant and benign tumors and twelve (12) blood samples from patients who are managed at the Aristide Le Dantec Hospital Cancer Institute. Samples were collected from these patients after informed and written consent in a standardized form.

DNA extraction, amplification and sequencing

DNA extraction was performed from tissues using the Qiagen DNeasy kit. Quality of the extracted DNA was verified by electrophoretic migration in 1,5% of agarose gel; DNA was then stored at a temperature of 20°C. PCR amplification of exon 15 of BRAF gene was carried out at a reaction volume of 50 μL containing 1 μL of DNA and 49 μL of the PCR mix comprising 34.9μL of MilliQ water, 5 μL of buffer 10X, 2 μL of MgCl2, 4μL of dNTP, 1.5 μL of each primer (Forward 5'- TCATAATGCTTGCTCTGATAGGA -3') (Reverse 5'- GGCCAAAAATTTAATCAGTGGA -3'). The PCR program included the following conditions: 95°C for 3 min; 35 cycles (95°C for 30 s; 55°C for 30 s; 72°C 30 s); 72°C for 10 min. PCR products were purified and sequenced. Sequencing reactions were performed using an MJ Research PTC-225 Peltier thermocycler with the ABI PRISM kit and electrophoresed in an ABI 3730 XL sequencer.

Molecular analyses

The exon 15 sequences of the BRAF gene, from the three groups (malignant, benign and control), are carefully verified, corrected and aligned with Bio Edit software version 7.0.8 [5]. Alignment is indeed an important step in data analysis. It is used in particular to highlight the similarities between the sequences by finding the position of deletions, insertions, and probable substitutions.

To determine the position, nature and frequency of exon 15 mutations in the BRAF gene, the raw sequencing data were submitted to Mutation Surveyor version 5.0.1 (www.softgenetics.com). Indeed, this software compares the chromatograms submitted with the reference sequence of the gene of interest incorporated in the database of the said software but also with sequences from the Genbank database (https://www.ncbi.nlm.nih.gov/genbank/). Thus this software allows detecting the presence of heterozygous mutations (het), insertions (in) and deletions (del).

In addition to the universality of the DNA molecule in the living world, there is its variability. This variability results in random changes in the DNA sequence (mutations) that can affect the cellular activity and the entire body. Therefore, to estimate the genetic diversity of the BRAF gene, we determined the number of variable and invariable sites, the number of informative sites, the total number of mutations, the number of haplotypes (h), the average number of nucleotide differences (k), the haplotypic (HD) and nucleotide (π) diversity, using the DnaSP software version 5.10 [6]. Nucleotide frequencies, nature of mutations (% transitions and transversions) and molecular distances with the Kimura 2 Parameter (K2P) model were calculated with the MEGA program version 6.06 [7]. Nucleotide frequencies and molecular distances were also calculated at each codon position.

The nucleotide sequences of the BRAF gene are transformed into amino acid sequences using MEGA software version 6.06 [7], using the best reading frame. The level of significance of amino acid frequency variations between the three groups (controls, benign tumors, and malignant tumors) was demonstrated by the chi2 test with a level of significance (P-value) of 0.05.

Genetic distances between controls vs TB, controls vs TM and TB vs TM at the intra- and inter-individual level were explained by Nei's genetic distance using the MEGA software version 6.06 [7].

We conducted demogenetic tests that compare the level of adjustment between diversity to the three groups and expected theoretical values. Among these tests: the D of Tajima [8], the D*and F* of Fu and Li [9] and the H of Fay and Wu [10] and the R2 of Ramos [11]. These different estimators are obtained with the DnaSP version 5.10 programs [6] and Harlequin version 3.5.1.3 [12]. By choosing as a starting hypothesis that exon 15 of the BRAF gene is under positive selection, the existence of any selection has been apprehended by a positivity (dN>dS) thanks to the MEGA 6 software with dN is the non- synonymous substitution rate and dS is the synonymous substitution rate. This test was performed using the Nei-Gojobori model and the pairwise deletion method. A value of P < 0.05 was considered significant with a bootstrap value of 10000 replications. After the demogenetic tests, we determined the analysis of the distribution disparity (Mismatch distribution), which is the graphical representation of the distribution of genetic distances existing between individuals. Mismatch's analysis is accompanied by two indices that test the quality of adjustment of the distribution. These indices are the SSD (sum of squares of deviations) and the Rag (irregularity index). The graphs are built with DnaSP software version 5.10 [6]. The SSD and Rag indices were obtained with Harlequin software version 3.5.1.3[12].

Results

A total of 86 sequences (12 for controls, 31 for benign tumors and 35 for malignant tumors) were sequenced, aligned and analyzed.

Nature and frequency of mutations

In benign tumors, we find the mutations L588H and D594V (1.5%), which correspond to a change of amino acid in position 588 in BRAF, with leucine (L) replaced by a histidine (H) and D594V to a change of amino acid in position 594 in BRAF with an aspartic acid (D) replaced by valine (V), Table 1. We also observe a synonymous mutation A598A, in malignant tumors.

Genetic diversity

The analysis in Table 2 shows that the BRAF gene is more diverse in terms of malignant tumors and TB than in controls. However, we note a great diversity among TMs. This increased diversity in malignant tumors is reflected in a high number of variable sites (20) compared to TB (17) and controls (8). We also note a higher total number of mutations (26) for TMs compared to TB (22) and controls (10). The average number of nucleotide differences (k) is higher at the TM levels (3.615) compared to TB (3.009) and controls (2.045).We find that the percentages of transversions are higher than those of transitions in the three groups. However, we note that in the percentages of transversions they are higher in controls and benign tumors respectively (73.42%) and (78.82%) compared to the TM (53.16%). In contrast, in malignant tumors, transitions (46.82%) are higher compared to TB (21.18%) and controls (26.51%) (Table 2). Analysis of the diversity indices reveals high haplotypic diversity of (0.818), (0.920) and (0.934) respectively in malignant, benign and control tumors against low nucleotide diversity (0.01130), (0.01662) and (0.01997) (Table 2).

In the nucleotide frequency diagram, we see that bases A and T are the most dominant with respectively 27% and 35% for all three groups compared to bases C and G respectively 17.5% and 20%. And we also notice a predominance of (A +T) in all three groups with a percentage of 62% compared to (C+G) 38%.

Variability of BRAF amino acids

The analysis of inter-tissue protein diversity (Table 3) by highlighting amino acid variations indicates that, despite slight variations in amino acid frequencies between the three groups, no significant difference could be determined.

Genetic differentiation

The genetic distance values (d) at the intra and inter tissue level and the degree of genetic differentiation (Fst) between controls and benign tumors and between controls and malignant tumors as well as benign and malignant tumors are recorded in Table 4. The analysis of genetic distances between controls and malignant tumors and benign and malignant tumors revealed a low respective genetic diversity (d=0.0159), (0.0186), but greater than that between controls and benign tumors (d=0.0139).We note that within malignant and benign tumors the values of the genetic distance are equal (d=0.02), higher than those of the controls (d=0.01). We also find that the degree of genetic differentiation shows an Fst that is equal to 0 and not significant (0; P-value=0.86486), (0; P-value=0.76577) and (0; P-value=0.48649) respectively between controls and benign tumors, controls and malignant tumors and between benign and malignant tumors.

Neutrality tests

Under the assumption of positive selection (dN>dS) the probability values for controls and benign and malignant tumors are respectively (0.01), (0.037) and (0.064) with p (1.023), (1.802) and (1.529) values that are not significant. Based on these results, the initial hypothesis is not accepted; therefore the substitutions at the level of exon 15 of the BRAF do not follow the positive selection. For Tajima D, the values for controls (-0.90996; p=0.2), TB (-0.99594; p=0.154) and TM (-0.86541; p=0.211) are not significantly negative. The D* and F* tests of (Fu & Li) and the H of (Fay & Wu) are negatively insignificant for all three groups; the values are reported in Table 5. Unlike the other indices for those of R2 de Ramos, the control values (0.16074; p=0.000), TB (0.16370; p=0.000) and TM (0.16088; p=0.000) are significantly positive.

Mismatch distribution analysis

The disparity of distribution (Mismatch distribution), base pairs for exon 15 of the BRAF gene between the three groups, shows the expected and observed frequencies (solid and dotted line respectively) of the differences per pair between the samples (Figure 3). Under the assumption of a constant population and an expanding population, we have a unimodal distribution for controls. However, the distribution is multimodal for benign and malignant tumors.

Discussion

We have identified mutations, studied genetic variability, genetic differentiation, and genetic evolution in order to determine the involvement of exon 15 of the BRAF gene in breast cancer in Senegalese women. 35 patients with breast cancer and 31 patients with benign breast tumors were included in this study. The data from these patients were compared to 12 control subjects used as controls. BRAF, which is a nuclear gene, is part of the RAF-MEK-ERK signaling cascade that regulates cell growth, proliferation and differentiation in response to stimulation by growth factors, cytokines and hormones [13]. For this role that plays in the cell justifies the study of the variability of its exon 15 in the context of cancer.

The mutation identification analysis of exon 15 of the BRAF gene showed us in benign tumors, the presence of mutations L588H and D598V which correspond to a change of amino acid in position 588 in BRAF, with a leucine (L) replaced by a histidine (H) and D598V to a change of amino acid in position 598 in BRAF with an aspartic acid (D) replaced by a valine (V). It has been shown by [14] that BRAF activating mutations are common in some benign tumors, such as scalloped colonic polyps, where their frequency reaches 51%, and melanocytic nevi. We observe a synonymous mutation A598A in malignant tumors. These results are different from the substitution of BRAF V600E resulting in the substitution of glutamic acid by valine, which accounts for 80% of mutations and is thought to be involved in 66% of malignant melanomas [3], and also involved in several other cancers [15]. In most cases, B-raf mutations are located in exon 15 [16]. In our study of the variability of exon 15 of the BRAF gene, several mutations have been described both in malignant and benign tumour sequences. This increased diversity in malignant tumors is reflected in a high number of variable sites (20) compared to TB (17) and controls (8). This justifies that the ability of tumour cells to invade and colonize distant sites is a major characteristic differentiating malignant and benign cancers [17]. We had transition percentages (46.82%) at the malignant tumour levels that are higher compared to benign (21.18%) and control (26.51%) tumors. Our results are in line with those of [18] working on the diagnosis of melanoma. The sequencing of BRAF showed the presence of very many mutations and 80% of the mutations were C > Transitions.

A comparative analysis of the genetic distance and degree of genetic differentiation (Fst), intra and inter healthy tissue, benign tissue and cancer tissue, of exon 15 of the BRAF gene was performed in a series of 78 patients with breast tumors. The analysis of genetic distances between controls and malignant tumors and benign and malignant tumors revealed a low respective genetic diversity (d=0.0159), (0.0186), but greater than that between controls and benign tumors (d=0.0139). And also we find that the degree of genetic differentiation shows a negative and insignificant Fst (-0.02652; P- value=0.86486), (-0.01890; P-value=0.76577) and (-0.00294; P-value=0.48649) respectively between controls and benign tumors, controls and malignant tumors as well as between benign and malignant tumors. We also found that within malignant and benign tumors, the genetic distance values are equal (d=0.02), higher than those of the controls (d=0.01). This shows that cancer cells have a different property from healthy cells [19], and it may also explain that during carcinogenesis, cancer-related changes the internal structures of the cells but also their environment. Cancer cells have been shown to be less rigid than normal cells due to a reorganization of the cytoskeleton [20]. Breast cancer cells deform more than non-cancerous cells [21].

The analysis of inter-tissue protein diversity by highlighting amino acid variations indicates that, despite slight variations in amino acid frequencies between the three groups, no significant difference could be determined. This can be explained by the aspect of the nuclear DNA gene that has less replication than the mtDNA gene.

Conclusion

Genetic mutations and molecular pathway activation play a vital role in tumour formation. The analysis at the identification of mutation of exon 15 of the BRAF gene led us to conclude that BRAF was mutated.

1Davies H, Bignell GR. and Cox C (2002) Mutations of the BRAF gene in human cancer. Nature 417: 949-954.
2Dhomen N, Da Rocha Dias S. and Hayward R (2010) Inducible expression of V600E BRAF using tyrosinase-driven Cre recombinase results in embryonic lethality. Pigment Cell Melanoma Research 23:112-120.
3Christine L and Lionel L (2012) BRAF : biologie et fonction. Correspondances enOnco-Théranostic.
4Wang YL, Dai X, Li YD, Cheng RX, Deng B, et al. (2015) Study of PIK3CA, BRAF, and KRAS mutations in breast carcinomas among Chinese women in Qinghai. Genetics and molecular research: GMR.7p.
5Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series. 44:211.
6Librado P and Rozas J (2009) DnaSP v5: Software for Comprehensive Analysis of DNA Polymorphic Data. Bioinformatics 25:1451-1452.
7Tamura K, Peterson D, Peterson N, Stecher G, Nei M, et al. (2013) MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. The Society for Molecular Biology and Evolution, Oxford University, Oxford.
8Tajima F (1989) Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123:585-595.
9Fu YX and Li WH (1993) Statistical tests of neutrality of mutations. Pub Med 133:693-709.
10Fay JC and Wu CI (2000) Hitchhiking under positive Darwinian selection. Genetics 155:1405– 1413.
11Ramos-Onsins SE and Rozas J (2002) Statistical properties of new neutrality tests against population growth. Molecular Biology and Evolution19: 2092-2100.
12Excoffier L and Lischer HEL (2010) Arlequin suite, Ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Molecular Ecologie Resources 10: 564- 567.
13Robinson MJ and Cobb MH (1997) Mitogen-activated protein kinase pathways. Current Opinion in Cell Biology 9:180- 186.
14Spring KJ, Zhao ZZ, Karamatic R, et al. (2006) High prevalence of sessile serrated adenomas with BRAF mutations: a prospective study of patients undergoing colonoscopy. Gastroenterology 131:1400-1407.
15RajagopalanH, Bardelli A ,Lengauer C, Kinzler KW, Vogelstein B, Velculescu VE (2002) Tumorigenesis: RAF/RAS oncogenes and mismatch-repair status. Nature 418: 934.
16Kimura ET, Nikiforova MN, Zhu Z (2003) High prevalence of BRAF mutations in thyroid cancer: genetic evidence for constitutive activation of the RET/PTC-RAS-BRAF signaling pathway in papillary thyroid carcinoma. Cancer Res 63:1454-1457.
17Eccles SA (2000) Cell biology of lymphatic metastasis. The potential role of c-erbB oncogene signaling. Recent Results Cancer Research 157:41-54.
18Benfodda M, Marinho E, Kuma R, Beaudoux O, Lamoril J, Deschamps L, et al. (2016) MELADIAG : un panel de biomarqueurs d'ADN dédié au diagnostique du mélanome.
19Hanahan D and Weinberg RA (2011) Hallmarks of cancer: the next generation. Cell 144: 646-74.
20Lekka M, Laidler P, Gil D, Lekki J, Stachura Z, et al. (1999) The elasticity of normal and cancerous human bladder cells studied by scanning force microscopy. European Biophysics Journal 28:312-316.
21Guck J, Schinkinger S, Lincoln B, Wottawah F, Ebert S, Romeyke M, Lenz D, et al. (2005) Optical Deformability as an Inherent Cell Marker for Testing Malignant Transformation and Metastatic Competence. Biophysical Journal 88: 3689-3698.
Figures at a glance
Figure 1
Figure 2
Figure 3
Tables at a glance
Table 1
Table 2
Table 3
Table 4
Table 5
Table 6

top